View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10881_low_29 (Length: 240)
Name: NF10881_low_29
Description: NF10881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10881_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 46932088 - 46932213
Alignment:
| Q |
1 |
ttgtgttattttgttgtttgggtgttaaattgtgtaaattcgtagaacatatggatgtactatctccgtgtgaaataaggtttgctcaaattttgtctc- |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46932088 |
ttgtgttattttgttgtttgggtgttaaattgtgtaaattcgtagaacatatggatgtactatctccgtgtgaaataaggtttgctcaaattttgtctca |
46932187 |
T |
|
| Q |
100 |
-agattttggtttagagttccaagct |
124 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
46932188 |
aagattttggtttagagttccaagct |
46932213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 181 - 223
Target Start/End: Original strand, 46932219 - 46932261
Alignment:
| Q |
181 |
tttcgtgtgttgataattttccaattaatcgcaatttcaatag |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46932219 |
tttcgtgtgttgataattttccaattaatcgcaatttcaatag |
46932261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University