View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10881_low_30 (Length: 235)
Name: NF10881_low_30
Description: NF10881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10881_low_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 7 - 188
Target Start/End: Complemental strand, 34342540 - 34342359
Alignment:
| Q |
7 |
agaagcaaaggaaaagcattgtggatgacgaactagtaatagtagttcttgtgatcagttgtcacatccaaactccaagccaagcaaccccaataatatt |
106 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34342540 |
agaatcaaaagaaaagcattgtggatgacgaactagtaatagtagttcttgtgatcagttgtcacatccaaactccaagccaagcaaccccaataatatt |
34342441 |
T |
 |
| Q |
107 |
taacactatataaattgatctttcatgatttatttgaattaattaagtcgacaaaacatataagtcgtaaagagttttaaaa |
188 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34342440 |
taacactacataaattgatctttcatgatttatttgaattaattaagtcgacaaaacatataagtcgtaaagagttttaaaa |
34342359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 185 - 219
Target Start/End: Complemental strand, 34342264 - 34342230
Alignment:
| Q |
185 |
aaaatttaagaagggtcatgctcttacgtgggatc |
219 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
34342264 |
aaaaattaagaagggtcatgctcttacgtgggatc |
34342230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University