View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10885_high_11 (Length: 210)

Name: NF10885_high_11
Description: NF10885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10885_high_11
NF10885_high_11
[»] chr4 (1 HSPs)
chr4 (17-196)||(47236638-47236817)


Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 17 - 196
Target Start/End: Original strand, 47236638 - 47236817
Alignment:
17 agggtaaggcaatgtgatataaaaaagtgcccacggcagtgagggaatgctgggaccggaatggaaattaaagttggttttttagttcatattggaaaac 116  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47236638 agggtaaggcaatgtgatataaaaaagtgtccacggcagtgagggaatgctgggaccggaatggaaattaaagttggttttttagttcatattggaaaac 47236737  T
117 cagatttcagtggacaataattactttcattttaattccatcacttttnnnnnnnntaatttaaatcagtatcatatgtg 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||    
47236738 cagatttcagtggacaataattactttcattttaattccatcacttttttaaaaaataatttaaatcagtatcatatgtg 47236817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University