View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10885_high_11 (Length: 210)
Name: NF10885_high_11
Description: NF10885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10885_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 17 - 196
Target Start/End: Original strand, 47236638 - 47236817
Alignment:
| Q |
17 |
agggtaaggcaatgtgatataaaaaagtgcccacggcagtgagggaatgctgggaccggaatggaaattaaagttggttttttagttcatattggaaaac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47236638 |
agggtaaggcaatgtgatataaaaaagtgtccacggcagtgagggaatgctgggaccggaatggaaattaaagttggttttttagttcatattggaaaac |
47236737 |
T |
 |
| Q |
117 |
cagatttcagtggacaataattactttcattttaattccatcacttttnnnnnnnntaatttaaatcagtatcatatgtg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
47236738 |
cagatttcagtggacaataattactttcattttaattccatcacttttttaaaaaataatttaaatcagtatcatatgtg |
47236817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University