View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10885_high_7 (Length: 307)
Name: NF10885_high_7
Description: NF10885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10885_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 1 - 301
Target Start/End: Original strand, 39120406 - 39120706
Alignment:
| Q |
1 |
cttaccttcctgatgcagtagcggcaaaaaatttctcagtcctccttaaaggatctggggctatgaagtgtgttgcctgatatgaccactgatgagaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39120406 |
cttaccttcctgatgcagtagcggcaaaaaatttctcagtcctccttaaaggatctggggctatgaagtgtgttgcctgatatgaccactgatgagaatc |
39120505 |
T |
 |
| Q |
101 |
acggcaaactcttcctttcaagcgcttgattacctgttgaaactcctttctctgtaggcgatgcccacttaaaataaaacatgtggtttcaggttttacc |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39120506 |
acggcaaactcttcctttcaaacgcttgattacctgttgaaactcctttctctgtaggcgatgcccacttaaaataaaacatgtggtttcaggttttact |
39120605 |
T |
 |
| Q |
201 |
cttgcattaaactctgatgtagatggagcatgtttcatttccttagacttgatatttgctggcttaacactagatttagttgttcgaacatttcttctct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39120606 |
cttgcattaaactctgatgtagatggagcatgtttcatttccttagacttgatatttgctggcttaacactagatttagttgttcgaacatttcttctct |
39120705 |
T |
 |
| Q |
301 |
c |
301 |
Q |
| |
|
| |
|
|
| T |
39120706 |
c |
39120706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University