View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10885_low_13 (Length: 288)
Name: NF10885_low_13
Description: NF10885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10885_low_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 20 - 280
Target Start/End: Complemental strand, 8166646 - 8166386
Alignment:
| Q |
20 |
tattgctcaagtaacttaaatacttactagcatttgcaagaacttctgatgaaacaccggttgtggatttatcttgaacaattttcagcaacacatcctt |
119 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8166646 |
tattgctctagcaacttaaatacttactagcatttgcaagaacttctgatgaaacaccagttttggatttatcttgaacaattttcggcaacacatcctt |
8166547 |
T |
 |
| Q |
120 |
tctagttttcttcgtcaaacgacattttttacataacaaaactccaaacaccaaaaccgcaagaacaaatccaagaatgatagcaactactgcaaccact |
219 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |||||||||||| | |||||||||| |
|
|
| T |
8166546 |
tctagttttcttcatcaaacgacattttttacataaaaaaactccaaacaccaaaaccgcaagaagaaatccaacaatgatagcaacgattgcaaccact |
8166447 |
T |
 |
| Q |
220 |
ttccattccttgaatctcaaccatcctaaacccgattccttacaataagaccctctctgct |
280 |
Q |
| |
|
||||||||||| ||| ||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8166446 |
ttccattccttcaatttcatccatcctaaacccgattccttacaataagaccctctctgct |
8166386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University