View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10885_low_14 (Length: 284)
Name: NF10885_low_14
Description: NF10885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10885_low_14 |
 | |
|
| [»] scaffold0036 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 19 - 277
Target Start/End: Complemental strand, 44147015 - 44146757
Alignment:
| Q |
19 |
gtcttgttgattcattttcttttctgtgcaaaatttgaggcaggaaaagtttctgcacgggcttggagctcgaacgcactcagctagcattttctctgcc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44147015 |
gtcttgttgattcattttcttttctgtgcaaaatttgaggcaggaaaagtttctgcacgggcttggagctcgaacgcactcagctagcattttctctgcc |
44146916 |
T |
|
| Q |
119 |
aacctcagctgggaaggcattagcctgtagttatgttgatactggatcgtttttggtgtataaattagtgtaattggggaagagaaacaaatgtggaatc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44146915 |
aacctcagctgggaaggcattagcctgtagttatgttgatactggatcgtttttggtgtataaattagtgtaattggggaagagaaacaaatgtggaatc |
44146816 |
T |
|
| Q |
219 |
agggagtctcatgtcattgttgaagctggaaatcaagtgtagatagcacgttcttctct |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44146815 |
agggagtctcatgtcattgttgaagctggaaatcaagtgtagatagcacgttcttctct |
44146757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 59; Significance: 5e-25; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 21 - 183
Target Start/End: Complemental strand, 7236 - 7074
Alignment:
| Q |
21 |
cttgttgattcattttcttttctgtgcaaaatttgaggcaggaaaagtttctgcacgggcttggagctcgaacgcactcagctagcattttctctgccaa |
120 |
Q |
| |
|
||||||||||||||||||| |||| | ||||||| |||||||||||||||||||| | ||||||||| |||| || |||||||||| ||| |||| |
|
|
| T |
7236 |
cttgttgattcattttcttctctgcactaaatttgtggcaggaaaagtttctgcaccgacttggagcttcaacgtgctgagctagcattctctgcaccaa |
7137 |
T |
|
| Q |
121 |
cctcagctgggaaggcattagcctgtagttatgttgatactggatcgtttttggtgtataaat |
183 |
Q |
| |
|
|||||| ||||||||||||||| |||| ||| | ||||||||| || ||||||||||||| |
|
|
| T |
7136 |
cctcagttgggaaggcattagcatgtaattacaccggtactggatcattcttggtgtataaat |
7074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University