View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10885_low_20 (Length: 239)
Name: NF10885_low_20
Description: NF10885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10885_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 39120423 - 39120199
Alignment:
| Q |
1 |
ctgcatcaggaaggtaaggaaatgcagccatgttaaaaaattaagtccgtaattctgtatagtgcgttcaaacattgatgcatgcatataaattgtctaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39120423 |
ctgcatcaggaaggtaaggaaatgcaggcatgttaaaaaattaagtccgtaattctgtatagtgcgttcaaacattgacgcatgcatataaattgtctaa |
39120324 |
T |
 |
| Q |
101 |
ctaatctctggtggaatgcaggtggattctgaaaactgatttcttaagtgccagtagccaggcagggaaattattgccagaggagccttatgagtggaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
39120323 |
ctaatctctggtggaatgcaggtggattctgaaaactgatttcttaagtgccagtagccaggcagggaaattattgccagaggagccttatgagtggcac |
39120224 |
T |
 |
| Q |
201 |
aaaaatggtctcagtgaggatggtg |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
39120223 |
aaaaatggtctcagtgaggatggtg |
39120199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University