View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10886_low_1 (Length: 457)
Name: NF10886_low_1
Description: NF10886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10886_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 410; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 410; E-Value: 0
Query Start/End: Original strand, 24 - 441
Target Start/End: Complemental strand, 2783605 - 2783188
Alignment:
| Q |
24 |
ccgtcgtccatggcgttcttctccaccgtctccacacaatccctccaccaacactgaacttcccttcctcctcttccgttcaccggaaatggcaaatgcg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2783605 |
ccgtcgtccatggcgttcttctccaccgtctccacacaatccctccaccaacactgaacttcccttcctcctattccgttcaccggaaatggcaaatgcg |
2783506 |
T |
|
| Q |
124 |
ccaccgtccggtaaccttactccggtctcgttaatctgttgaagcgatcgtaactaaccgtccgtcaatcccggagagattgttagggcggttatggcga |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2783505 |
ccaccgtccggtaaccttactccggtctcgttaatctgttgaagcgatcgtaactaaccgtccgtcaatcccggagagattgttagggcggttatggcga |
2783406 |
T |
|
| Q |
224 |
agggaggacaatgcttgttggagaagctttggaggtgtattcgaacggttttctttgttgttgcattggtggtttcgcttattgttacgtcgcttccggt |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2783405 |
agggaggacaatgcttgttggagaagctttggaggtgtattcgaacggttttctttgttgttgcattggtggtttcgctgattgttacgtcgcttccggt |
2783306 |
T |
|
| Q |
324 |
ggttgttgcggtggttgatgttcttgttccgtgtgttttgatctccaattttacttgtgttaattgctatagtttcaaacagcttcttcgtcgttactct |
423 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2783305 |
ggttgttgcggtggttgatgttcttgttccgtgtgttttgatctccaattttacttgtgttaattgctatagtttcaaacagcttcttcgtcgttactct |
2783206 |
T |
|
| Q |
424 |
ttcaagagttctttgatg |
441 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
2783205 |
ttcaagagttctttgatg |
2783188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University