View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10886_low_3 (Length: 236)
Name: NF10886_low_3
Description: NF10886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10886_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 18 - 225
Target Start/End: Complemental strand, 33531278 - 33531071
Alignment:
| Q |
18 |
gaaagtcaaggattggaaagttatattgaaggaaacacagtctgcaatatccttaggtgtggattcagctccaaaggttagtttctttggttaaatgttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33531278 |
gaaagtcaaggattggaaagttatattgaaggaaacacagtctgcaatatccttaggtgtggattcagctccaaaggttagtttctttggttaaatgttt |
33531179 |
T |
 |
| Q |
118 |
tattttaggcactcctacannnnnnnnaatcatatgttactcaactcattggccaataaccctcttatgctgattnnnnnnntggttatgtctaccaggt |
217 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33531178 |
tattttaggcactcctacattttttttaatcatatgttactcaactcattggccaataaccctcttatgctgattaaaaaaatggttatgtctaccaggt |
33531079 |
T |
 |
| Q |
218 |
ctctgctt |
225 |
Q |
| |
|
|| ||||| |
|
|
| T |
33531078 |
ctatgctt |
33531071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 46 - 106
Target Start/End: Complemental strand, 26209143 - 26209083
Alignment:
| Q |
46 |
aaggaaacacagtctgcaatatccttaggtgtggattcagctccaaaggttagtttctttg |
106 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||| ||||||||| ||||| |
|
|
| T |
26209143 |
aaggaaacacagtctgcattatccttaggtgccgattcagctccacaggttagttcctttg |
26209083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University