View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10887_high_3 (Length: 216)
Name: NF10887_high_3
Description: NF10887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10887_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 64 - 205
Target Start/End: Complemental strand, 158305 - 158164
Alignment:
| Q |
64 |
tccactttattattactcaccaactccttgattttattccttttatttcttcctcccaaccttctaacattgaaggttgtaataatcattgattgcaatt |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
158305 |
tccactttattattactcaccaactccttgattttattccttttatttcttcctcccaaccttctaacattgaaggttgtaataatcattgattgcaatt |
158206 |
T |
 |
| Q |
164 |
tagtctctcccttgctaccttcaatcctacatcaccttcttc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
158205 |
tagtctctcccttgctaccttcaatcctacatcaccttcttc |
158164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University