View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10887_low_4 (Length: 239)
Name: NF10887_low_4
Description: NF10887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10887_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 12 - 223
Target Start/End: Complemental strand, 4468849 - 4468638
Alignment:
| Q |
12 |
gagatgaattggtcgagattgacgttaggtcagtacctgcagtcactctgacgttcaagtcaatgattgagcaaagagtatgagatagaaagtggatata |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4468849 |
gagatgaattggtcgagattgacgttaggtcagtacctgcagtcactctgacgttcaagtcaatgattgagcaaagagtatgagatagaaagtggatata |
4468750 |
T |
 |
| Q |
112 |
aattgacaaattgtgtaccttgcatttgtggtgaaagaagcatgtattttataggcactgacaaggagttgttagagactgacaaagggttcgttacata |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4468749 |
aattgacaaattgtgtaccttgcatttgtggtgaaagaagcatgtattttataggcactgacaaggagttgttagagattgacaaagggttcgttacata |
4468650 |
T |
 |
| Q |
212 |
cgacgtttatca |
223 |
Q |
| |
|
| |||||||||| |
|
|
| T |
4468649 |
ctacgtttatca |
4468638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University