View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10888_9 (Length: 363)
Name: NF10888_9
Description: NF10888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10888_9 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 3 - 363
Target Start/End: Complemental strand, 56327412 - 56327056
Alignment:
| Q |
3 |
gctagagctggtcttcatcctcttgatcaggaagttggaaaatggttgcgcaaaaatgcacctcaacttaaacctattcttgttatgaataaatctgaat |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56327412 |
gctagagctggtcttcatcctcttgatcaggaagttggaaaatggttgcgcaaaaatgcacctcaacttaaacctattcttgttatgaataaatctgaat |
56327313 |
T |
|
| Q |
103 |
ccctctttgatgttgatggctctcttgcttctgctgccaatgaaatgtcccgtttatgttttggagatcctattgctatttctgctgagactggacttgg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56327312 |
ccctctttgatgttgatggctctcttgcttcttctgccaatgaaatgtcccgtttagggtttggagatcctattgctatttctgctgagactggacttgg |
56327213 |
T |
|
| Q |
203 |
tatgcatgacttgtttctctcacttcaacctgttttggaggactatatgctgagtaagtacccttttatttatttatttattataaaaatgataacttca |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
56327212 |
tatgcatgacttgtttctctcacttcaacctgttttggaggactatatgctgagtaagtacccttttatttatt----tattataaaaatgataacttca |
56327117 |
T |
|
| Q |
303 |
agcttattttgattctaatatcttcctttgattctacactcaattgttattcatcatagat |
363 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| || |||||||||||||||||||||| |
|
|
| T |
56327116 |
agcttattttgattctaatatcttcttttgattctgcattcaattgttattcatcatagat |
56327056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University