View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10888_low_2 (Length: 236)
Name: NF10888_low_2
Description: NF10888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10888_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 72 - 217
Target Start/End: Complemental strand, 3423624 - 3423479
Alignment:
| Q |
72 |
gaattacaaccatttagcttgcttggatagcaagtatatcaactaataagtcttaaccaacctgttacttgaaatccacataacagttagaaactaactc |
171 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3423624 |
gaattacactcatttagcttgcttgtatagcaagtatatcaactaataagtcttaaccaacctgttacttgaaatccacataacagttagaaactaactc |
3423525 |
T |
|
| Q |
172 |
aactaactctccaagttagttaactaataaactttaaccaagattg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3423524 |
aactaactctccaagttagttaactaataaactttaaccaagattg |
3423479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 66 - 141
Target Start/End: Original strand, 109270 - 109345
Alignment:
| Q |
66 |
tacaatgaattacaaccatttagcttgcttggatagcaagtatatcaactaataagtcttaaccaacctgttactt |
141 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||||||||||||||| || |||||| |||| |||||||| |
|
|
| T |
109270 |
tacaatgaattacaaccatttaacttgcttatatagcaagtatatcaactaacaaatcttaatcaacatgttactt |
109345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University