View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10888_low_4 (Length: 223)
Name: NF10888_low_4
Description: NF10888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10888_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 21 - 216
Target Start/End: Original strand, 18029805 - 18030000
Alignment:
| Q |
21 |
atcggtgtcgggcaaagcaacaatgggcatggcacgttgtctaacggcatagattttgtcgtctacagaggttgtactcctgcgagcatgttcttcggct |
120 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18029805 |
atcggtgtcggggaaagcaacaatgggcatggcacgttgtctaacggcatagattttgtcgtctacagaggttgtactcctgcgagcatgttcttcggct |
18029904 |
T |
 |
| Q |
121 |
actgattccgagtattttgtgaaatcccacggagactgtgttttcttctttgaaactcgtggttctttgtactcttcttctttctctgctcctcct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
18029905 |
actgattccgagtattttgtgaaatcccacggagactgtgttttcttctttgaaactcgtggttctttgtactcttcttctttctcttctactcct |
18030000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 71 - 189
Target Start/End: Original strand, 19680038 - 19680156
Alignment:
| Q |
71 |
agattttgtcgtctacagaggttgtactcctgcgagcatgttcttcggctactgattccgagtattttgtgaaatcccacggagactgtgttttcttctt |
170 |
Q |
| |
|
||||||| |||||||| || |||||||||| |||||| |||||||| || |||||||| ||||||| ||||| ||||| |||||||||||||||||||| |
|
|
| T |
19680038 |
agattttatcgtctactgatgttgtactccggcgagcgtgttcttcagcaactgattcagagtattgagtgaagtcccatggagactgtgttttcttctt |
19680137 |
T |
 |
| Q |
171 |
tgaaactcgtggttctttg |
189 |
Q |
| |
|
|||||||| ||||||||| |
|
|
| T |
19680138 |
cgaaactcgcggttctttg |
19680156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University