View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1088_low_8 (Length: 337)
Name: NF1088_low_8
Description: NF1088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1088_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 48 - 332
Target Start/End: Original strand, 51668431 - 51668715
Alignment:
| Q |
48 |
atgaaaaacctcctcttcttctccagatggttcgtgactccgaagatattaaattcatgtaaggtttattgttcggctggtttgattttcgcaacttgct |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51668431 |
atgaaaaacctcctcttcttctccagatggttcgtgactccgaagatattaaattcatgtaaggtttattgttcggctggtttgattttcgcaacttgct |
51668530 |
T |
|
| Q |
148 |
tatggtttagaaactgaatcatgaacaaacaacatattaaatctctttctctacaggtctgctttacggtccttcaaacgccgcgttgcctatgcaaata |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
51668531 |
tatggtttagaaactgaatcatgaacaaacaacatattaaatctctttctctacaggtctgctttacggtccttcaaacgccgcgttgcttatgcaaata |
51668630 |
T |
|
| Q |
248 |
ttcgttatgaccgtatccttttgttttagttcagaaacattaaccattgcatattctatttttatcgcaattaaattctactgtc |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
51668631 |
ttcgttatgaccgtatccttttgttttagttcagaaacattaaccattgcatattctattattatcgcaattaaattctactgtc |
51668715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University