View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10890_low_11 (Length: 228)
Name: NF10890_low_11
Description: NF10890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10890_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 146 - 211
Target Start/End: Complemental strand, 9812188 - 9812123
Alignment:
| Q |
146 |
gttacaaaagtggaaggatgtgaccaaataataaatttttgctagatcagtgtaaaactgatttac |
211 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9812188 |
gttaccaaagtggaaggatgtgaccaaataataaatttttgctagatcagtgtaaaactgatttac |
9812123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University