View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10890_low_11 (Length: 228)

Name: NF10890_low_11
Description: NF10890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10890_low_11
NF10890_low_11
[»] chr2 (1 HSPs)
chr2 (146-211)||(9812123-9812188)


Alignment Details
Target: chr2 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 146 - 211
Target Start/End: Complemental strand, 9812188 - 9812123
Alignment:
146 gttacaaaagtggaaggatgtgaccaaataataaatttttgctagatcagtgtaaaactgatttac 211  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9812188 gttaccaaagtggaaggatgtgaccaaataataaatttttgctagatcagtgtaaaactgatttac 9812123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University