View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10890_low_7 (Length: 291)
Name: NF10890_low_7
Description: NF10890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10890_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 9 - 281
Target Start/End: Original strand, 45100925 - 45101197
Alignment:
| Q |
9 |
ttactgagggtttagaccgcttgtaataattgatagtctaaaatctgcgaagaatggttttctaggtggtctataattcttgtagtgccaagtttggatt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45100925 |
ttactgagggtttagaccgcttgtaataacttatagtctaaaatctgccaagaatgcttttctaggtggtctataattcttgtagtgccaagtttggatt |
45101024 |
T |
 |
| Q |
109 |
gctagatatatttctttcgcttgtgggggtaatacattcaactttacacacatagttgttgagttggcagtcgagtcacgcttaacttccttattgctag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45101025 |
gctagatatatttctttcgcttgtgggggtaatacattcaactttacacacatagttgttgagttggcagtcgagtcacgcttaacttccttattgctag |
45101124 |
T |
 |
| Q |
209 |
ttttgtaattgttcatatgaatagtagaaactaaatattggtccgtataggttatcttattgatttctctctg |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45101125 |
ttttgtaattgttcatatgaatagtagaaactaaatattggtccgtataggttatcttattgatttctctctg |
45101197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University