View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10891_low_13 (Length: 281)
Name: NF10891_low_13
Description: NF10891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10891_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 34 - 263
Target Start/End: Original strand, 41079900 - 41080129
Alignment:
| Q |
34 |
aaatatcagggtctctgtcaatgaaaggtgtgtagggtgaagaggtttgtgagattgttgagaagaaggtttttggtccagctgaggttagggtttgttt |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41079900 |
aaatatcagggtctctgtcaatgaaaggtgtgtagggagaagaggtttgtgagattgttgagaagaaggtttttggtccagctgaggttagggtttgttt |
41079999 |
T |
 |
| Q |
134 |
tgttgtttgaaaaatttggcctccaacgtcgattgtgactatgtttgtgtctgatctgaaaacaccaatgggatgagaacctgcaaagggtggcattttg |
233 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41080000 |
tgttgtttgaaaaatttggccaccaacgtcgattgtgactatgtttgtgtctgatctgaaaacaccaacgggatgagaacctgcaaagggtggcattttg |
41080099 |
T |
 |
| Q |
234 |
aatgagacggagaggagaaggtgatatgat |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41080100 |
aatgagacggagaggagaaggtgatatgat |
41080129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University