View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10891_low_14 (Length: 259)
Name: NF10891_low_14
Description: NF10891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10891_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 7 - 247
Target Start/End: Original strand, 40975710 - 40975948
Alignment:
| Q |
7 |
catactactgtcaaacgatcgatcacaatatgttgtgattgttcctctctctttggcaattcaaattattgaagctgaaaacaagcttagattagaaggt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
40975710 |
catactactgtcaaacgatcgatcacaatatgttgtgattgttcctctctctttggca-ttcaaattattgaagcagaaaacaaacttagattagaaggt |
40975808 |
T |
 |
| Q |
107 |
tgcaaagatcatttcatgggagtttgattactttagggtgatannnnnnnnaacaatcgttgatttgcatgcaaagttgtcttctatttggaaacttatt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40975809 |
tgcaaagatcatttcatgggagtttgattactttagggtgatattctttttaacaatcgttgatttgcatgcaaagttgtcttctatttggaaacttatt |
40975908 |
T |
 |
| Q |
207 |
agtcattgacatctgaagccaaagtattttacatctatccc |
247 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40975909 |
agtcattgacatctgaagcc-aagtattttacatctatccc |
40975948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University