View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10891_low_2 (Length: 424)
Name: NF10891_low_2
Description: NF10891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10891_low_2 |
 | |
|
| [»] scaffold0006 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 98 - 409
Target Start/End: Complemental strand, 27574778 - 27574480
Alignment:
| Q |
98 |
caaattgaaagtagagaggcagatgatgtacctagaaaatgaagagaagggcaaccaatttgagaagaatatgctttctctaccactgaaggtgccctga |
197 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27574778 |
caaattgaaag--gagaggcagatgatgtacctagaaaatgaagagaagggcaaccaatttgagaagaatatgctttctctaccactgaaggtgccctga |
27574681 |
T |
|
| Q |
198 |
actttgcccctcctattattataaggaatttcactttgggaactttcgtgagtgccacaccct--acatataaaaatttacacaacttaaaatataaatg |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27574680 |
actttgcccctcctattattataaggaatttcactttgggaactttcgtgagtgccacaccctacacatataaaaatttacacaacttaaaatataaatg |
27574581 |
T |
|
| Q |
296 |
caccaatttgaagcaaagcaacgtggactaacgacagatgaattaaaagtcaatccatgtttccagttttttacataccttctcctgaagacctggcagt |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27574580 |
caccaatttgaagcaaagcaacgtggactaacgacagatgaattaaaagt-------------cagttttttacataccttctcctgaagacctggcagt |
27574494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 45 - 101
Target Start/End: Complemental strand, 172135 - 172079
Alignment:
| Q |
45 |
atcaaattcaaaatacatgaccgatctaaggggagaacgtgatttcatactatcaaa |
101 |
Q |
| |
|
|||| |||| ||||||| ||||||||||| ||||||||| |||||| |||||||||| |
|
|
| T |
172135 |
atcagattctaaatacaggaccgatctaaagggagaacgggatttcttactatcaaa |
172079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 45 - 101
Target Start/End: Original strand, 6926796 - 6926852
Alignment:
| Q |
45 |
atcaaattcaaaatacatgaccgatctaaggggagaacgtgatttcatactatcaaa |
101 |
Q |
| |
|
|||| |||| ||||||| ||||||||||| ||||||||| |||||| |||||||||| |
|
|
| T |
6926796 |
atcagattctaaatacaggaccgatctaaagggagaacgggatttcttactatcaaa |
6926852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 45 - 101
Target Start/End: Original strand, 502053 - 502109
Alignment:
| Q |
45 |
atcaaattcaaaatacatgaccgatctaaggggagaacgtgatttcatactatcaaa |
101 |
Q |
| |
|
|||| |||| ||||||| ||||||||||| ||||||||| |||||| |||||||||| |
|
|
| T |
502053 |
atcagattctaaatacaggaccgatctaaagggagaacgggatttcttactatcaaa |
502109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 45 - 101
Target Start/End: Complemental strand, 13674521 - 13674465
Alignment:
| Q |
45 |
atcaaattcaaaatacatgaccgatctaaggggagaacgtgatttcatactatcaaa |
101 |
Q |
| |
|
|||| |||| ||||||| ||||||||||| |||||||| ||||||| |||||||||| |
|
|
| T |
13674521 |
atcagattctaaatacaggaccgatctaaagggagaacatgatttcttactatcaaa |
13674465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 45 - 101
Target Start/End: Complemental strand, 20482805 - 20482749
Alignment:
| Q |
45 |
atcaaattcaaaatacatgaccgatctaaggggagaacgtgatttcatactatcaaa |
101 |
Q |
| |
|
|||| |||| ||||||| ||||||||||| |||||||| |||||| |||||||||| |
|
|
| T |
20482805 |
atcagattctaaatacaggaccgatctaaagggagaacaggatttcttactatcaaa |
20482749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University