View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10891_low_20 (Length: 238)
Name: NF10891_low_20
Description: NF10891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10891_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 66 - 227
Target Start/End: Original strand, 9500426 - 9500585
Alignment:
| Q |
66 |
aacatttatgtgtgtaacgtaatataaatataaattacttgtagtttataagtaaaagccggttattggtattgaagtcatcctggtatctggtatgctt |
165 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9500426 |
aacatttatgtgtataacgtaatataaatataaattacttgta--ttataagtaaaatccggttattggtattgaagtcatcctggtatctggtatgctt |
9500523 |
T |
 |
| Q |
166 |
ttgggatagaaggctcctcatttctatttgggattgacaactatgattattgctctctgctt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9500524 |
ttgggatagaaggctcctcatttctatttgggattgacaactatgattattgctctctgctt |
9500585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University