View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10891_low_21 (Length: 233)
Name: NF10891_low_21
Description: NF10891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10891_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 18 - 172
Target Start/End: Original strand, 23030372 - 23030526
Alignment:
| Q |
18 |
acttgtacctagtttacttattacttagttgtttagtttgtattgcgcaagctacttaattattttgcatatgttagttagattgtttacgttgtttcat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23030372 |
acttgtacctagtttacttattacttagttgtttagtttttattgcacaagctacttaattattttgcatatgttagttagattgtttacgttgtttcat |
23030471 |
T |
 |
| Q |
118 |
ctataaaccataaacgttgaagccaaagtcaccacacgttatcaatgaaattttg |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23030472 |
ctataaaccataaacgttgaagccaaagtcaccacacgttatcaatgaaattttg |
23030526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 168 - 233
Target Start/End: Original strand, 23030565 - 23030632
Alignment:
| Q |
168 |
ttttgatgtgtaaatgct--aacaatgacatacttcaattttacacgcaaaaaatgttttgccaattt |
233 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23030565 |
ttttgatgtgtaaatgctctaacaatgacatacttcaattttacacgcaaaaaatgttttgccaattt |
23030632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University