View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10891_low_22 (Length: 229)

Name: NF10891_low_22
Description: NF10891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10891_low_22
NF10891_low_22
[»] chr4 (1 HSPs)
chr4 (18-63)||(41407383-41407428)


Alignment Details
Target: chr4 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 18 - 63
Target Start/End: Complemental strand, 41407428 - 41407383
Alignment:
18 ccaacaacaatttggcagtcaatttaagaatatgaagttttttccc 63  Q
    |||||||||||||||||||||||||||||||||||||| |||||||    
41407428 ccaacaacaatttggcagtcaatttaagaatatgaagtcttttccc 41407383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University