View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10891_low_26 (Length: 213)
Name: NF10891_low_26
Description: NF10891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10891_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 19 - 195
Target Start/End: Complemental strand, 8908340 - 8908164
Alignment:
| Q |
19 |
ggccgttattggtcatcatacctctctcctcttggaaagccttctcagccagtgtaagtattgtgacattaccatactaataactgtctaaaactctaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8908340 |
ggccgttattggtcatcatacctctctcctcttggaaagccttctcagccagtgtaagtattgtgacattaccatagtaataactgtctaaaactctaaa |
8908241 |
T |
 |
| Q |
119 |
ttacatgcatgcagtcaagacatgtatatggttagtgatagtagttgaagctaaaatcttgtttccatgtcttgttt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8908240 |
ttacatgcatgcagtcaagacatgtatatggttagtgatagtagttgaagctaaaatcttgtttccatgttttgttt |
8908164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University