View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10891_low_28 (Length: 207)
Name: NF10891_low_28
Description: NF10891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10891_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 34 - 194
Target Start/End: Original strand, 22191970 - 22192130
Alignment:
| Q |
34 |
gattatacagaaatcaaacaattggagtgaaaacttccataaaaacatttgagatgggaaacaacatttggagatggtcattgtggatgctaaagtcata |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22191970 |
gattatacagaaatcaaacaattggagtgaaaacttccataaaaacatttgagatgggaaagaacatttggagatggtcattgtggatgctaaagtcata |
22192069 |
T |
 |
| Q |
134 |
ttctatactttcgtgatctttactgttttttacttaagcaaatgtaatgacatgttatttt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22192070 |
ttctatactttcgtgatctttactgttttttacttaagcaaatgtaatgacatgttatttt |
22192130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University