View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10891_low_9 (Length: 293)
Name: NF10891_low_9
Description: NF10891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10891_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 71 - 264
Target Start/End: Complemental strand, 37981046 - 37980858
Alignment:
| Q |
71 |
atagatagtgcagtgtggtggtggtggcggggacctgaaggatatcggggtaaggtaaggcaaagtttgtggggtcataatactacttccctttcaaacg |
170 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37981046 |
atagatagtgcagtgcggtggtggtggcggggacctcaaggatatcggggtaagg-----caaagtttgtggggtcataatactacttccctttcaaacg |
37980952 |
T |
 |
| Q |
171 |
tgggtcccagcagtgaattttggtccttttggattttcctgtttttccaactataaatcaaacccacaccctatgtcctcttcccccatttcca |
264 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37980951 |
tgggtcccaccagtgaattttggtccttttggattttcctgtttttccaactataaatcaaacccacaccctatgtcctcttcccccacttcca |
37980858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 6 - 46
Target Start/End: Complemental strand, 37981115 - 37981075
Alignment:
| Q |
6 |
aggaacaaagtaatagtagttgtttcagtttgaagcagtgt |
46 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
37981115 |
aggaacaaagtaatagtagtagtttgagtttgaagcagtgt |
37981075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University