View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10892_3 (Length: 490)

Name: NF10892_3
Description: NF10892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10892_3
NF10892_3
[»] chr5 (5 HSPs)
chr5 (379-456)||(9624916-9624993)
chr5 (397-456)||(9621183-9621243)
chr5 (386-446)||(9622905-9622966)
chr5 (199-235)||(9217963-9217999)
chr5 (132-168)||(9629051-9629087)


Alignment Details
Target: chr5 (Bit Score: 78; Significance: 4e-36; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 379 - 456
Target Start/End: Original strand, 9624916 - 9624993
Alignment:
Q  379 gagtactaaaaaatatgcagcaactgcagcttgaacggtctcttttgttttgcttctttagaatgaatctatcctttg 456  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9624916 gagtactaaaaaatatgcagcaactgcagcttgaacggtctcttttgttttgcttctttagaatgaatctatcctttg 9624993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 397 - 456
Target Start/End: Original strand, 9621183 - 9621243
Alignment:
Q  397 agcaactgc-agcttgaacggtctcttttgttttgcttctttagaatgaatctatcctttg 456  Q
    ||||||||| ||| |||||||||| ||||||||||||||||||||||| |||| |||||||    
T  9621183 agcaactgccagcctgaacggtcttttttgttttgcttctttagaatggatctgtcctttg 9621243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 386 - 446
Target Start/End: Original strand, 9622905 - 9622966
Alignment:
Q  386 aaaaaatatgcagcaactg-cagcttgaacggtctcttttgttttgcttctttagaatgaat 446  Q
    ||||||||||  ||||||| ||||||||||||||| ||||||||| |||||||||| |||||    
T  9622905 aaaaaatatgatgcaactgtcagcttgaacggtcttttttgtttttcttctttagactgaat 9622966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 199 - 235
Target Start/End: Complemental strand, 9217999 - 9217963
Alignment:
Q  199 ttgtaatctcggttgcaaaatatggaagctcaatttt 235  Q
    ||||||||||||||||||||||||| |||||||||||    
T  9217999 ttgtaatctcggttgcaaaatatggcagctcaatttt 9217963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 132 - 168
Target Start/End: Original strand, 9629051 - 9629087
Alignment:
Q  132 agagactaacctgcactagatgtgcatttgttagaga 168  Q
    |||||||||||||||||||||||||| ||||||||||    
T  9629051 agagactaacctgcactagatgtgcacttgttagaga 9629087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University