View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10893_high_7 (Length: 241)
Name: NF10893_high_7
Description: NF10893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10893_high_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 134; Significance: 7e-70; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 4076961 - 4077106
Alignment:
| Q |
1 |
agaactacattaacggcaaacaaaacaatcacacatgtatgttttcttgctactatgctcaagattggaaaattcgaggtatggtagttttttggtgaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4076961 |
agaactacattaacggcaaacaaaacaatcacacatgtatgttttcttgctactatgctcaagattggagcattcgaggtatggtagttttttggtgaaa |
4077060 |
T |
|
| Q |
101 |
ttttttctcaagatattgtgtttgttacaaagtatataggaattta |
146 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4077061 |
ttttttctcaagctattgtgtttgttacaaagtatataggaattta |
4077106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 4178874 - 4178786
Alignment:
| Q |
1 |
agaactacattaacggcaaacaaaacaatcacacatgtatgttttcttgctactatgctcaagattggaaaattcgaggtatggtagtt |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |||||||||||| ||||| |
|
|
| T |
4178874 |
agaactacattaacggcaaacaaaacaatcacacatgtatgttttctggctactttgctcaagattggaagattcgaggtatgatagtt |
4178786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 166 - 226
Target Start/End: Original strand, 4077182 - 4077242
Alignment:
| Q |
166 |
cttcttctttcaagttttctctttaaaagagaaatagtctaggataagagatggtatatgt |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4077182 |
cttcttctttcaagttttctctttaaaagagaaatagtctaggataagagatggtatatgt |
4077242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 88 - 123
Target Start/End: Complemental strand, 4178755 - 4178720
Alignment:
| Q |
88 |
ttttttggtgaaattttttctcaagatattgtgttt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4178755 |
ttttttggtgaaattttttctcaagatattttgttt |
4178720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University