View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10893_low_14 (Length: 238)
Name: NF10893_low_14
Description: NF10893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10893_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 133 - 236
Target Start/End: Original strand, 10311885 - 10311988
Alignment:
| Q |
133 |
atacctggtcatggtacttgtcaccaatgatgacaaacatggacatatgccttgttttgacaccattttcaatgagagttctgattcgctcatccacctt |
232 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| || ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10311885 |
atacctggtcatagtacttgtcaccaatgatgacaaacatggacctatgccttgttttaacgccattctcaatgagagttctgattcgctcatccacctt |
10311984 |
T |
|
| Q |
233 |
cttc |
236 |
Q |
| |
|
|||| |
|
|
| T |
10311985 |
cttc |
10311988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 132 - 236
Target Start/End: Original strand, 38436224 - 38436328
Alignment:
| Q |
132 |
gatacctggtcatggtacttgtcaccaatgatgacaaacatggacatatgccttgttttgacaccattttcaatgagagttctgattcgctcatccacct |
231 |
Q |
| |
|
|||||||| ||| || | |||||||| || |||||||||||||| |||||||| |||||| |||||||| || ||||||||||| || |||||||||| |
|
|
| T |
38436224 |
gatacctgatcacgggatttgtcaccgataatgacaaacatggatcgatgccttgatttgacgccattttcgataagagttctgatacgttcatccacct |
38436323 |
T |
|
| Q |
232 |
tcttc |
236 |
Q |
| |
|
||||| |
|
|
| T |
38436324 |
tcttc |
38436328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University