View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10894_high_3 (Length: 445)
Name: NF10894_high_3
Description: NF10894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10894_high_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 18 - 303
Target Start/End: Complemental strand, 33757270 - 33756985
Alignment:
| Q |
18 |
ctgtgacggtaacggaaatgactgtgacggtgacggtgattgtgattgagaagaatgtttattaatcatgaagagagtgaaagcattaaaagtggttcga |
117 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33757270 |
ctgtgacggtaatggaaatgactgtgactgtgacggtgattgtgattgagaagaatgtttattaatcatgaagagagtgaaagcattaaaagtggttcga |
33757171 |
T |
|
| Q |
118 |
attggtgtattggaaataacattgagaatttgaagagcttgattttctgccatcgttgcgaggagtcgtatcgttgaaggatcgagtggtggctgtgatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33757170 |
attggtgtattggaaataacattgagaatttgaagagcttgattttctgccatcgttgcgaggagtcgtatcgttgaaggatcgagtggtggttgtgatt |
33757071 |
T |
|
| Q |
218 |
gtttcacgcatatttggtttattagattttctacggatgccggaagtgtcaccggtggttgctccgtcgccataactaactttcac |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33757070 |
gtttcacgcatatttggtttattagattttctacggatgccggaagtgtcaccggtggttgctccgtcgccataacaaactttcac |
33756985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University