View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10894_low_2 (Length: 250)
Name: NF10894_low_2
Description: NF10894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10894_low_2 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 14 - 250
Target Start/End: Complemental strand, 37968222 - 37967986
Alignment:
| Q |
14 |
agaaatcgagccactaccttcaatttaaaacttccaaagtctattgaaacaaaaacacatgaaaaaggaatttcaacttacaattaatctcaatctctcc |
113 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37968222 |
agaaatcgagccactgccttcaatttaaaacttccaaagtctattgaaacaaaaacacatgaaaaaggaatttcaacttacaattaatctcaatctctcc |
37968123 |
T |
|
| Q |
114 |
atagtagatattgcaagtcgatcaccctgaaccttcaagttttccaaattcgcatagattctgctcaaaaccttatcaggtgtctcttcccccaaatcaa |
213 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37968122 |
atagtcgatattgcaagtcgatcaccctgaaccttcaagttttccaaattcgcatagattctgctcaaaaccttatcaggtgtctcttcccccaaatcaa |
37968023 |
T |
|
| Q |
214 |
acacctaaacaaacacacacaagctcaattcattcct |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37968022 |
acacctaaacaaacacacacaagctcaattcattcct |
37967986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University