View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10895_high_4 (Length: 240)
Name: NF10895_high_4
Description: NF10895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10895_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 45824916 - 45824691
Alignment:
| Q |
1 |
gacatttcttccttcattaccaacacatactgcttttcctctctggcttcattcttcattttctatatcttgtgaatnnnnnnnnnnnnnnnnnnnntgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
45824916 |
gacatttcttccttcattaccaacacatactgcttttcctctctggcttcattcttcattttctatatcttgtgaataaaaaataaaacaagaaaaatgt |
45824817 |
T |
 |
| Q |
101 |
tt--actcatggtagtagagtttagcttaataaatttaaatgcaatttagttggataatattgcttgggatctgtgcactaatcatcgtatccatatttt |
198 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45824816 |
ttttactcatggtagtagagtttagcttaataaatttaaatgcaatttagttggataatattgcttgggatctgtgcactaatcatcgtatccatatttt |
45824717 |
T |
 |
| Q |
199 |
tatctccttaatttcattttaaggac |
224 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
45824716 |
tatctccttaatttcattttaaggac |
45824691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University