View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10895_low_3 (Length: 253)
Name: NF10895_low_3
Description: NF10895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10895_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 45824912 - 45825141
Alignment:
| Q |
1 |
atgtcacgtgatgtaccatctctcatcaggtttctcaatattctgaagcatggaaattgatctttttagctgtgccgtcaaaaacgggattcnnnnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45824912 |
atgtcacgtgatgtaccatctctcatcaggtttctcaatattctgaagcatggaaattgatctttttagctgtgccgtcaaatacgggattcttttttt- |
45825010 |
T |
 |
| Q |
101 |
nnnnnnnaaagggtctcttagattaaacaatgttattgatcatcaaaaaataattaaacaatgttgttgatcatcaacaataattaaacaatgttatgta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45825011 |
-------aaagggtctcttagattaaacaatgttattgatca---aaaaataattaaacaatgttgttgatcatcaacaataattaaacaatgttatgta |
45825100 |
T |
 |
| Q |
201 |
tgtttttgttctttactttctctacatgctttgccctatgc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45825101 |
tgtttttgttctttactttctctacatgctttgccctatgc |
45825141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University