View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10895_low_8 (Length: 232)
Name: NF10895_low_8
Description: NF10895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10895_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 14 - 214
Target Start/End: Complemental strand, 19370854 - 19370654
Alignment:
| Q |
14 |
caaaggatttagtggtaaagaaaggttgtagcctggtttggaatgatacaaacttatccaagttggttagagctaacatttccggtcggcatattatgtt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19370854 |
caaaggatttagtggtaaagaaaggttgtagcctggtttggaatgatacaaacttatccaagttggttagagctaacatttccggtcggcatattatgtt |
19370755 |
T |
|
| Q |
114 |
taagcaacttcataacgtcgagcatctgcgcctacatgtggtatgtatatatatttatcaaatttacaaaatactagcaaattacattagtctgttaaat |
213 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19370754 |
taagcaacttcataacgtggagcatctgcgcctacatgtggtatgtatatatatttatcaaatttacaaaatactagcaaattacattagtctgttaaat |
19370655 |
T |
|
| Q |
214 |
t |
214 |
Q |
| |
|
| |
|
|
| T |
19370654 |
t |
19370654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 58 - 159
Target Start/End: Original strand, 31211211 - 31211312
Alignment:
| Q |
58 |
gatacaaacttatccaagttggttagagctaacatttccggtcggcatattatgtttaagcaacttcataacgtcgagcatctgcgcctacatgtggtat |
157 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||| ||| ||||||| ||| | || |||||||| || |||||||||||||||||| |||||| |
|
|
| T |
31211211 |
gatacaagcttatccaaattggttagagctaacatttctggtttgcatatttattttgatcagcttcataatgtggagcatctgcgcctacatatggtat |
31211310 |
T |
|
| Q |
158 |
gt |
159 |
Q |
| |
|
|| |
|
|
| T |
31211311 |
gt |
31211312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University