View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10896_high_16 (Length: 215)
Name: NF10896_high_16
Description: NF10896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10896_high_16 |
 |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 30 - 201
Target Start/End: Complemental strand, 365263 - 365092
Alignment:
| Q |
30 |
agtgaatgttggtaatcaacaattctattcaaaatgttatttgtgagataggttttttagaatccattcatctttgttgccatatgcagcactcacattt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
365263 |
agtgaatgttggtaatcaacaattctattcaaaatgttatttgtgagataggttttttagaatccattcatcttcgttgccatatgcagcactcacattt |
365164 |
T |
 |
| Q |
130 |
gttggtggagatttttaatttaaatgagcaaattcttaatatttccaacatgtaattagaaaagcaacttat |
201 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
365163 |
gttggtgaagatttttaatttaaatgagcaaattcttaatatttccaacatgtaattagaaaaacaacttat |
365092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 35 - 78
Target Start/End: Complemental strand, 24183556 - 24183513
Alignment:
| Q |
35 |
atgttggtaatcaacaattctattcaaaatgttatttgtgagat |
78 |
Q |
| |
|
||||||||||||||||| ||||||||| | |||||||||||||| |
|
|
| T |
24183556 |
atgttggtaatcaacaactctattcaacaggttatttgtgagat |
24183513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 37 - 77
Target Start/End: Original strand, 243878 - 243918
Alignment:
| Q |
37 |
gttggtaatcaacaattctattcaaaatgttatttgtgaga |
77 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||| |||| |
|
|
| T |
243878 |
gttggtaatcaacaactctattcaaaaagttatttgcgaga |
243918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University