View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10896_high_6 (Length: 318)
Name: NF10896_high_6
Description: NF10896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10896_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 18 - 305
Target Start/End: Original strand, 9810788 - 9811075
Alignment:
| Q |
18 |
acatggtgccacaattctacgttaagcttgctctggtatattggaatatgtgtgagagatgactttggtcattttgttgtggctagaatggttggcgtga |
117 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
9810788 |
acatggtgccacaattctacattaagcttgctctggtatattggaatatgtgtgagagatgactttggtcattttgttgtggctagaatggttggcgtca |
9810887 |
T |
|
| Q |
118 |
catgactcttcaagatgcaattgcaaagtgtgaagcacctggggcttagcttgtataatattcttctatgtatattcacaatgcacaacaatctaaggag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9810888 |
catgactcttcaagatgcaattgcaaagtgtgaagcacctggggcttagcttgtataatattcttctatgtatattcacaatgcacaacaatctaaggag |
9810987 |
T |
|
| Q |
218 |
tgtttactatacgacaagctaatgatagtgtttatgtcttgccaaaacttatttcgcttatgctgcttgtagttatttccattatcct |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9810988 |
tgtttactatacgacaagctaatgatagtgtttatgtcttggcaaaacttatttcgcttatgctgcttgtagttatttccattatcct |
9811075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University