View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10896_low_15 (Length: 243)
Name: NF10896_low_15
Description: NF10896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10896_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 34 - 226
Target Start/End: Original strand, 41603041 - 41603233
Alignment:
| Q |
34 |
gttcacttgctagaattcaaagaagaaagttcaatttgttttttgaaaaatgtgtcatccacataccgaagatgagatacgacttctttcgaattctcag |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41603041 |
gttcacttgctagaattcaaagaagaaagttcaatttgttttttgaaaaatgtgtcatccacataccgaagatgagatacgacttctttcgaattctcag |
41603140 |
T |
|
| Q |
134 |
tctggatccccttaaatagcctagtcctactgcctttttcatcaacgctcccataccttccacaaccaatacaaatagatatggggctaaaag |
226 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||| ||||||||||| |
|
|
| T |
41603141 |
tctggatccccttaaatagcctagtccaactgcctttttcatcaacgctcccataccttccacaatcaatagaaatagatacggggctaaaag |
41603233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University