View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10896_low_17 (Length: 242)
Name: NF10896_low_17
Description: NF10896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10896_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 33392622 - 33392848
Alignment:
| Q |
1 |
tctcttatatgctcttaaagtcctctaatatttatagctaaaaagaatagatg-ttaattgtaaggaccataggtaatagaaaatcaagaatttatgcaa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33392622 |
tctcttatatgctcttaaagtcctctaatatttatagctaaaaagaatagatgattaattgtaaggaccataggtaatagaaaatcaagaatttatgcaa |
33392721 |
T |
 |
| Q |
100 |
atttccatagacacatacaccatcaatattaaagctga--nnnnnnnnaaaataattatagctcaatttgctgaacagcttcaaacatttaaattagtaa |
197 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33392722 |
atttccatggacacatacaccatcaatattaaagctgatttttttttaaaaataattatagttcaatttgctgaacagcttcaaacatttaaattagtaa |
33392821 |
T |
 |
| Q |
198 |
gaaccactgatttcttggcatgtttag |
224 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
33392822 |
gaaccactgatttcttggcatgtttag |
33392848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University