View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10896_low_18 (Length: 241)

Name: NF10896_low_18
Description: NF10896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10896_low_18
NF10896_low_18
[»] chr7 (1 HSPs)
chr7 (189-241)||(32239768-32239820)
[»] chr3 (1 HSPs)
chr3 (189-241)||(46470046-46470098)


Alignment Details
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 189 - 241
Target Start/End: Original strand, 32239768 - 32239820
Alignment:
189 atctatacatcttacaaagcatttgcttccaattttactgtgcgattcacttc 241  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
32239768 atctatacatcttacaaagcatttgcttccaattttactgtgcgattcacttc 32239820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 189 - 241
Target Start/End: Original strand, 46470046 - 46470098
Alignment:
189 atctatacatcttacaaagcatttgcttccaattttactgtgcgattcacttc 241  Q
    ||||||||||||||||||| |||||||||| |||||||||||| |||| ||||    
46470046 atctatacatcttacaaaggatttgcttccgattttactgtgcaattcccttc 46470098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University