View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10896_low_18 (Length: 241)
Name: NF10896_low_18
Description: NF10896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10896_low_18 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 189 - 241
Target Start/End: Original strand, 32239768 - 32239820
Alignment:
| Q |
189 |
atctatacatcttacaaagcatttgcttccaattttactgtgcgattcacttc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32239768 |
atctatacatcttacaaagcatttgcttccaattttactgtgcgattcacttc |
32239820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 189 - 241
Target Start/End: Original strand, 46470046 - 46470098
Alignment:
| Q |
189 |
atctatacatcttacaaagcatttgcttccaattttactgtgcgattcacttc |
241 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||| |||| |||| |
|
|
| T |
46470046 |
atctatacatcttacaaaggatttgcttccgattttactgtgcaattcccttc |
46470098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University