View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10896_low_23 (Length: 212)
Name: NF10896_low_23
Description: NF10896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10896_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 14 - 194
Target Start/End: Complemental strand, 55578040 - 55577860
Alignment:
| Q |
14 |
aagaaaagaagctaagcagtactatagttttatgcaaggccacaatcttgtgttcaatgccagtatggatcacgatggtgatccaaaatcccaacccttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55578040 |
aagaaaagaagctaagcagtactatagttttatgcaaggccacaatcttgtgttcaatgccagtatggatcacgatggtgatccaaaatcccaacccttt |
55577941 |
T |
 |
| Q |
114 |
gctgaaagtcgtccatcctatccagtattttgtctgtcatagctgaggggtatttccaagatacagccataatggccctcc |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55577940 |
gctgaaagtcgtccatcctatccagtattttgtctgtcatagctgaggggtatttccaagatacagccataatggccctcc |
55577860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University