View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10896_low_5 (Length: 354)
Name: NF10896_low_5
Description: NF10896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10896_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 1 - 337
Target Start/End: Original strand, 4982043 - 4982379
Alignment:
| Q |
1 |
ctaatgcaaaagtatgaggtaggacgcatgcttggccaaggaagttttgccaaagtttaccatgcaaggaacttaaagacaggacaaaatgttgctatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4982043 |
ctaatgcaaaagtatgaggtaggacgcatgcttggccaaggaagttttgccaaagtttaccatgcaaggaacttaaagacaggacaaaatgttgctatca |
4982142 |
T |
|
| Q |
101 |
aggtgttcgacaaagcgatgatcatgaaagtcggtttgaaggagcaaatcaagcgtgaaatctcggttatgcgtcttgttcgacaccctaacattgtcga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4982143 |
aggtgttcgacaaagcgatgatcatgaaagtcggtttgaaggagcaaatcaagcgtgaaatctcggttatgcgtcttgttcgacaccctaacattgtcga |
4982242 |
T |
|
| Q |
201 |
attctacgaggtcatggcaagcaaaacaaagatatattttgcaatggaacaagtgaaaggtggcgagcttttccataaagtgtctcgagggaagctgagg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4982243 |
attctacgaggtcatggcaagcaaaacaaagatatattttgcaatggaacaagtgaaaggtggcgagcttttccataaagtgtctcgagggaagctgagg |
4982342 |
T |
|
| Q |
301 |
gaagatatggctaggaaatatttccagcaacttattg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4982343 |
gaagatatggctaggaaatatttccagcaacttattg |
4982379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University