View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10896_low_9 (Length: 277)
Name: NF10896_low_9
Description: NF10896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10896_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 20 - 258
Target Start/End: Complemental strand, 14021059 - 14020821
Alignment:
| Q |
20 |
cagtattgtttgtgttgtggtggtggtgatgaatgtgaatgcatttttggatttggagtgaggttaagatttaagaatatgagatttatgatgatgaatt |
119 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14021059 |
cagtattgtttgtgttgtggtgatggtgatgaatgtgaatgcatttttggatttggagtgaggttaagatttaagaatatgagatttatgatgatgaatt |
14020960 |
T |
 |
| Q |
120 |
gataatgaagctaaaaatagatgacccatctagttttaattttgtttgtctatatattgaaacactccattttatgacagttgttctcgaaagcatcaat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14020959 |
gataatgaagctaaaaatagatgacccatctagttttaattttgtttgtctatatattgaaacactccattttatgacagttgttctcgaaagcatcaat |
14020860 |
T |
 |
| Q |
220 |
gtcgttttagcacacacacctgcattttccgtttttcat |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14020859 |
gtcgttttagcacacacacctgcattttccgtttttcat |
14020821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University