View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10897_high_2 (Length: 311)
Name: NF10897_high_2
Description: NF10897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10897_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 15 - 300
Target Start/End: Complemental strand, 38624025 - 38623740
Alignment:
| Q |
15 |
acaaagtaccacactgaaatttatgtactgttgtcttttgtgaaaacaatttatatttgcagctccatagctcaaagtctaaactagactaaatgcatgt |
114 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38624025 |
acaaagtaccacagtgaaatttatgtactattgtcttttgtgaaaacaatttatatttgcagctccatagctcaaagtctaaactagactaaatgcatgt |
38623926 |
T |
 |
| Q |
115 |
ttgattgtaagctgaaaatagttttttcctaaaatgccgagctgaggtagattcaattcagaagctgtttattggagcttcagtttcatcgtatgattat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38623925 |
ttgattgtaagctgaaaatagttttttcctaacatgccgagctgaggtagattcaatgcagaagctgttttttggagcttcagtttcatcgtatgattat |
38623826 |
T |
 |
| Q |
215 |
annnnnnngccttgatatatggtgagtggtcgttgttgactatgacagtttgactgcaaatttgggatcaatttttcttaccctat |
300 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38623825 |
atttttttgccttgatatatggtgagtggtcgttgttgactatgacagtttgactgcaaatttgggatcaatttttcttaccctat |
38623740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University