View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10897_low_7 (Length: 224)
Name: NF10897_low_7
Description: NF10897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10897_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 19 - 206
Target Start/End: Original strand, 41937470 - 41937657
Alignment:
| Q |
19 |
gctttacatctagggcttccaagtataagttcatctgatttagcttcttcaaatatttacaaagatgatgaaaaagtagtgactgttgattcttctgaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41937470 |
gctttacatctagggcttccaagtataagttcatctgatttagcttcttcaaatatttacaaagatgatgaaaaagtagtgactgttgattcttctgagt |
41937569 |
T |
|
| Q |
119 |
gtccaccaaataaaattagtaggggtcagtattggatccctacccctgctcagattctaatcggtccaacacagttttcatgccctct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41937570 |
gtccaccaaataaaattagtaggggtcagtattggatccctacccctgctcagattctaatcggtccaacacagttttcatgccctct |
41937657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 141 - 191
Target Start/End: Complemental strand, 21038462 - 21038412
Alignment:
| Q |
141 |
gggtcagtattggatccctacccctgctcagattctaatcggtccaacaca |
191 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||| || ||||| ||||| |
|
|
| T |
21038462 |
gggtcagtattggatccctactccttctcagattcttattggtcctacaca |
21038412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University