View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10901_high_14 (Length: 271)
Name: NF10901_high_14
Description: NF10901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10901_high_14 |
 | |
|
| [»] scaffold0179 (1 HSPs) |
| | |
|
| [»] scaffold0177 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0179 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 264
Target Start/End: Original strand, 1637 - 1882
Alignment:
| Q |
19 |
aatgtatctttaattttggttttgcttactttctagtttagattaggtggcgtaaggcttttgtaatacttcgtgtctcgacaggtttttagtaggttga |
118 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
1637 |
aatgtatctttaattttggttttgattactttctagtttagattaggtggcgtaaggcctatgtaatacttggtgtcttgacaggtttttagtaggttga |
1736 |
T |
|
| Q |
119 |
atttggtgtaannnnnnnncctcatctagctctagtgcgtcattgagttcctcatctaactcttatggttccgttgcgattcttcatacttgtatattga |
218 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1737 |
atttggtgtaattttttttcctcatctagctctagtgcgtcattgagttcctcatctaactcttatggttccgttgcgattcttcatacttgtatattga |
1836 |
T |
|
| Q |
219 |
taggatggatgacatatgtggcattcttcattctaagttcttctct |
264 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
1837 |
taggatggatgacatatgtggcattcatctttctaagttcttctct |
1882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0177 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: scaffold0177
Description:
Target: scaffold0177; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 26 - 169
Target Start/End: Original strand, 30061 - 30204
Alignment:
| Q |
26 |
ctttaattttggttttgcttactttctagtttagattaggtggcgtaaggcttttgtaatacttcgtgtctcgacaggtttttagtaggttgaatttggt |
125 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| ||||| ||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30061 |
ctttaattttggtttttcttactttctagtttagattaggtggcttaagggtttcataatacttggtgtctcgacaggtttttagtaggttgaatttggt |
30160 |
T |
|
| Q |
126 |
gtaannnnnnnncctcatctagctctagtgcgtcattgagttcc |
169 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||| |
|
|
| T |
30161 |
gtaattttttttcctcatctagctctagtgtctcattgagttcc |
30204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University