View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10901_high_16 (Length: 261)
Name: NF10901_high_16
Description: NF10901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10901_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 250
Target Start/End: Complemental strand, 40098290 - 40098040
Alignment:
| Q |
18 |
agcttcactctcgtttctcacttggcagacaatcttccctcgcaccggatcacgacggttccgccaccgtcaactcactggtaaccgactccgtaactgt |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40098290 |
agcttcactctcgtttctcactcggcagacaatcttccctcgcaccggatcacgacggttccgccaccgtcaactcactggtaaccgactccgtaactgt |
40098191 |
T |
 |
| Q |
118 |
aaccgact------------------tggtggatcccaccgttcggttgatgtatttagcgaacgaaggtgacttagaaggaatcaccgaacttctagac |
199 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40098190 |
aaccgactccgtaactgtaaccgacttggtggatcccaccgttcggttgatgtatttagcgaacgaaggtgacttagaaggaatcaccgaacttctagac |
40098091 |
T |
 |
| Q |
200 |
gacggtagtgacgtcaatttccgtgacactgacggccgctccgctcttcat |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40098090 |
gacggtagtgacgtcaatttccgtgacactgacggccgctccgctcttcat |
40098040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University