View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10901_low_20 (Length: 246)
Name: NF10901_low_20
Description: NF10901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10901_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 52166419 - 52166648
Alignment:
| Q |
1 |
ttgtggttgttagtactgctcatggtttgaaatttgcagatagtaagattgattatcattctgggaatattgctggaattggtcgttttgctaatccacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52166419 |
ttgtggttgttagtactgctcatggtttgaaatttgcagatagtaagattgattatcattctgggaatattgctggaattggtcgttttgctaatccacc |
52166518 |
T |
|
| Q |
101 |
tgtttctgttaaggctgattttggttccgttatggatgtgttgaaagattttctgttgagtaaagcaccaaagtagtttgtagtacaaggttaatttgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52166519 |
tgtttctgttaaggctgattttggttccgttatggatgtgttgaaagattttctgttgagtaaagcaccaaagtagtttgtagt---aggttaatttgga |
52166615 |
T |
|
| Q |
201 |
gttgtcgttttcactttttcagttgtacctata |
233 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
52166616 |
gttgtcgttttcactttttcagttgtccctata |
52166648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University