View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10901_low_21 (Length: 244)
Name: NF10901_low_21
Description: NF10901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10901_low_21 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 244
Target Start/End: Complemental strand, 47887174 - 47886948
Alignment:
| Q |
18 |
aaaagtagttgtttatttggaaggcccccctggaggcactgacattcttctaaatacttttgttataaagcatgcagctaaatcaccaccttcgacaccc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47887174 |
aaaagtagttgtttatttggaaggcccccctggaggcactgacattcttctaaatacttttgttataaagcatgcagctaaatcaccaccttcgacaccc |
47887075 |
T |
 |
| Q |
118 |
ccggattttgaggttaggctttcatcatattttctgcagattactttaatttctctttacacattcattgttactcaaacacttaattgtttctatgatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47887074 |
ccggattttgaggttaggctttcatcatattttctgcagattactttaatttctctttacacattcattgttactcaaacacttaattgtttctatgatg |
47886975 |
T |
 |
| Q |
218 |
ccttttgttgtgtggtcgattctgtat |
244 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
47886974 |
ccttttgttgtgtggtcgattctgtat |
47886948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University