View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10901_low_26 (Length: 214)
Name: NF10901_low_26
Description: NF10901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10901_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 124 - 196
Target Start/End: Complemental strand, 10368546 - 10368474
Alignment:
| Q |
124 |
cacaagtttggtgacatttatataggctctttgtagatgacatattaaatcaatcaatccgttgaattgaaag |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10368546 |
cacaagtttggtgacatttatataggctctttgtagatgacatattaaatcaatcaatccgttgaattgaaag |
10368474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 10 - 62
Target Start/End: Complemental strand, 10368660 - 10368608
Alignment:
| Q |
10 |
tgagatgaaggagaagaagaagaatggagttcaaagattcagatttgttttct |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10368660 |
tgagatgaaggagaagaagaagaatggagttcaaagattcagatttgttttct |
10368608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 13 - 53
Target Start/End: Original strand, 36116774 - 36116814
Alignment:
| Q |
13 |
gatgaaggagaagaagaagaatggagttcaaagattcagat |
53 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36116774 |
gatgaaggagaagaagaataatggagttcaaagattcagat |
36116814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University