View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10903_high_4 (Length: 276)
Name: NF10903_high_4
Description: NF10903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10903_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 171 - 259
Target Start/End: Complemental strand, 32452842 - 32452754
Alignment:
| Q |
171 |
atattctccatgtaaaacattgtccattgattgacatgtagaatgtctaaataaatgaggcttgtaatactggttggcatagccaaaat |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32452842 |
atattctccatgtaaaacattgtccattgattgacatgtagaatgtctacataaatgaggcttgtaatactggttggcatagccaaaat |
32452754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 10 - 79
Target Start/End: Original strand, 3260780 - 3260849
Alignment:
| Q |
10 |
gcacagagatactaattaagaagactgaaaaaataaattttaaattgagaaagacagttacaatactata |
79 |
Q |
| |
|
||||||||||||| ||||||||| || ||| |||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
3260780 |
gcacagagatactcgttaagaagattgcaaatataaattttaaattgagaaagacatttataatactata |
3260849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University